Thursday, September 30, 2010

More on DNA...

Today Mdm Riza taught us more on DNA and we had created our own model of a DNA strand.

Below are the pictures of my DNA model strand:
3 Thoughts:
1) DNA code is made up of codons (combination of 3 letters), known as DNA genes, which will form instructions that will tell the cells what types of proteins to produce.
2) I have learnt that DNA code is made up of only 4 letters. The letters are A, T, C, G and they are known as the bases of all compounds and molecules. A: Adenine, T: Thymine, C: Cytosine, G: Guanine. Adenine will always pair up with Thymine with double bonds while Cytosine will always pair up with Guanine with triple bonds. Triple bongs are stronger than double bonds. Hence the more bonds there is, the stronger the compounds or molecules.
3) DNA is made up of double strands as the bases pair up together. Codons will be formed when the letters come in sets of three. Codons which are formed at the complementary strand are also known as the complementary codons. One of the strands is called the original strand while the other strand is called the complementary strand.
Original strand:             AAGCCGTTCTAGTAGCCGCCGAAGTTC
Complementary strand: TTCGGCAAGCTCATCGGCGGCTTCAAG

2 Questions:
1) What if one pair is left in the DNA? Does this means that no more codons can be formed?
2) Will there be any errors in DNA? (Like having Cytosine to pair up with Thymine)

1 Useful application:
1) With the knowledge of DNA, we will be able to understand why our bodies are formed this way and what give the instructions to our cells that will form our proteins.

Wednesday, September 29, 2010

DNA in fruits

Today we have an experiment on DNA in fruits. It is really interesting and fun as we can see how a fruit DNA looks like. It is my first time seeing a real DNA and an experience that I will never forget.

3 Thoughts:
1) I have learnt that DNA stands for Deoxyribonucleic Acid and it is the genetic material of cells that is made up of double strands. The double strands will then form a helical structure.
2) I learn that we have to break the physical membranes that enclosed the cells, in other word lyse, to release the nucleus by adding dishwashing detergent to the mashed fruit. The detergent will then cause the cell membranes and those surrounding the nucleus to be degraded.
3) Adding ice cold 95% ethanol in the final step of the experiment is very important because enzymes have to be protected from degrading (reducing the amount of) the DNA at that point.

2 Questions:
1) What if we add in too much detergent to the mashed fruit? Will there be any effects?
2) Why is table salt also added to the mashed fruit?

1 Useful application:
1) Since we know the steps to extracting DNA, we will be able to try out the extraction of DNA in fruits by ourselves at home. Some people may not have a chance to see how a fruit DNA looks like. Hence, we can carry out the experiment and show it to them.

(Extractions of DNA)
   

Sources: Google Images

Monday, September 27, 2010

Parts of a Microscope

Today, we have a chance to handle with microscope. We were told to try out the different parts of a microscope and to examine our cheek cells. We really enjoyed ourselves today!

3 Thoughts:
1) There are around 13 different parts in a microscope. Some examples of the parts are: eye piece (place eyes over it to examine the cells), diaphragm (adjust the light), stage (place specimens), fine adjustment knob (for clearer image), etc.
2) When we start to examine the cells, we must always start with the lowest magnification of the objective lens. We must bear in mind that we should not start with the highest magnification because if we do so, the cells that we are examining will not be clear.
3) We should always add iodine on the specimens so that we are able to see the cells through the microscope.

2 Questions:
1) When examining the cells, why when we start with the highest magnification, the image of the cells will not be clear?
2) What will happen if we prepare the slides by using more than one layer of cells?

1 Useful applications:
1) By knowing the different parts of the microscope and their functions, we are able to examine cells by ourselves. We will also be able to examine the cells without the help of others if we know the steps to operate the microscope well.

(Pictures of microscopes)
 

Sources: Google Images

Friday, September 24, 2010

Recalling Back on Atoms, Elements, Compounds and Mixtures

The headline is: Recalling Back on Atoms, Elements, Compounds and Mixtures.

The headline is so because we have done a revision worksheet on atoms, elements, compounds and mixtures in today's science lesson. The worksheet has indeed helped me to recall the concepts of the topic. Although the worksheet is quite difficult, I managed to answer all the questions. Some of the questions were really challenging. Hence, we discussed the questions with our friends in groups. At the end of the lesson, we are told to hand in the science worksheet. I really enjoyed the science lesson today as the worksheet has helped me to revise on the concepts that Mdm Riza has taught us. I hope that there will be more revision worksheets for us to do in the next science lesson! :)

(An atom)                                     (Elements)
  
(Compounds)                                   (Mixtures)
 

Sources: Google Images

Thursday, September 23, 2010

Concept Map on Multicellular Organism

Today, Mdm Riza told us to do a concept map on multicellular organism, which is made up of cells, tissues, organs and systems. We had to complete the concept map and hand it in by the end of the lesson.

3 Thoughts:
1) Photosynthetic is a type of plant tissue that is found in both the stems and leaves of a plant. Its function is to make food as chlorophyll is present in it.
2) Division of labour occurs in multicellular organisms as they are made up of different types of cells. This process helps organisms function efficiently as a whole because it helps to breakdown workload so that different types of cells can perform specific tasks.
3) Tissues are formed when similar cells perform similar function; Organs are formed when several tissues work together; Systems are formed when different organs work together; Organisms form when different systems work as a whole.

(Cells)                                              (Tissue)
 

(Organs)                               (Systems)                                   
  

2 Questions:
1) In division of labour, how does the workload being breakdown? Is there a special method?
2) Does a tissue looks like similar cells being stick together?

1 Useful application:
1) By knowing more about multicellular organisms, we will be able to understand how our bodies function and why cells, tissues, organs and systems are present in our bodies. We are also able to know what make up the different parts of our bodies.

Sources: Google Images

Monday, September 20, 2010

Cells Come Alive

Today we did an experiment on cells. It was very interesting and fun! We had to make use of items that were given by Mdm Riza and brought by the members in our group so as to create an edible cell. Our group decided to make an edible plant cell.

(A plant cell)


3 Thoughts:
1) I had learnt that mitochondria, which is found in both plant and animal cells, break down food to provide energy. It is peanut-shape looking and is known as the powerhouses of the cell.

(Image of a mitochondria)


2) Golgi apparatus look like strings. Hence, we used strings in our cell that we made so as to represent the Golgi apparatus.

(Image of Golgi apparatus)


3) Plant cell contains 1 vacuole which is big in size. Vacuole contains cell sap that is made up of water and dissolved materials (e.g. sugars and mineral salts).

(Image of a plant's vacuole)

2 Questions:
1) Do the shapes and sizes of different parts of the plant cell affect the functions of the parts?
2) Do the parts of the similar type (e.g. chloroplasts) have the same shape and size?

1 Useful application:
1) By knowing the functions and appearances of the different parts of a plant cell, we are able to visualise the plant cell in our mind and know what create it.

Sources: Google Images

Thursday, September 16, 2010

Activity on Cells

Today, we were told to read out the resume that we had done to Mdm Riza which is so called an 'interview'. We have to finish reading the resume in one minute. It was really fun!

I used to think that cytoplasm is a jelly-like substance which it only carry substances around the cells with no special functions. But now I think that cytoplasm is a jelly-like substance which contains chemicals and other tiny structures that carry out special functions. One example is the vacuoles that are located in the cytoplasm of the cells. Vacuoles are filled with fluid and they store food and water.