Correcting Our Answers in Worksheets

In today's Science lesson, we went through answers in worksheets that we had done in the past few weeks. I feel that this will help me in my revision as it allows us to recall back what we had learnt. I also had gained some new knowledge after the lesson.

3 Thoughts:
1) There are two types of methods used in desalination. The first is distillation and the second method is reverse osmosis. In reverse osmosis, some steps are almost similar to the method of filtration as there is a presence of partially-permeable membrane which its function is similar to the function of filter paper used in the filtration. Both filter paper and partially-permeable membrane only allow certain substances to pass through.
2) I learnt that sublime means change in state directly from solid to gas, without even turning into the liquid state. One example is the solid iodine. To separate a small amount of substance, which sublimes to the effect of heat, from a mixture, we must first heat the mixture in an evaporating dish with an inverted filter funnel placed above the dish. The substances will then be formed on the wall of the inverted filter funnel.
3) I now know that concentrated means to remove any inessential substances. Example, if you want to get concentrated syrup means that you want more of the syrup and less amount of water.

2 Questions:
1) Reverse osmosis or distillation is a better method to obtain NEWater?
2) Can the partially-permeable membrane used in reverse osmosis be replaced with a stronger and firmer filter paper?

1 Useful application:
1) Such new knowledge will help me to understand how NEWater is obtained from the method of reverse osmosis.

(Reverse osmosis)                        (Subliming)
 

Sources: Google Images

Answering DNA Notes

For today's science lesson, we went through the notes on DNA and answered a few questions on it. We also had completed some parts on the cells worksheet. I felt that the questions were quite challenging!

3 Thoughts:
1) Letters in DNA has a special name which is called nitrogenous bases. Each of the letters is attached to a molecule of sugar while a phosphate molecule will attach to the sugar molecule. As both sugar and phosphate molecule is attached to one another, the sugar-phosphate will form the backbone of DNA.
2) I have learnt that nucleotide, which is a building block of DNA, is formed when the each of the bases, sugars and phosphates are linked together.
3) When the double stranded DNA is twisted like a spiral staircase with a hollow interior, it is called DNA double helix. The DNA is covered with proteins, chromatin and chromatids which will then form chromosome. Chromatin wound around the proteins so as to help join the DNA and prevent it from breaking.

2 Questions:
1) Will there be an ending in DNA strand?
2) Won't the DNA break if both the proteins and chromatin are removed?

1 Useful application:
1) With the help of the descriptions of a DNA, we can roughly know how a DNA strand looks like. We are also able to understand what surround the DNA and their functions in helping the DNA.

(DNA strands)
 

Sources: Google Images

More on DNA...

Today Mdm Riza taught us more on DNA and we had created our own model of a DNA strand.

Below are the pictures of my DNA model strand:

3 Thoughts:

1) DNA code is made up of codons (combination of 3 letters), known as DNA genes, which will form instructions that will tell the cells what types of proteins to produce.

2) I have learnt that DNA code is made up of only 4 letters. The letters are A, T, C, G and they are known as the bases of all compounds and molecules. A: Adenine, T: Thymine, C: Cytosine, G: Guanine. Adenine will always pair up with Thymine with double bonds while Cytosine will always pair up with Guanine with triple bonds. Triple bongs are stronger than double bonds. Hence the more bonds there is, the stronger the compounds or molecules.

3) DNA is made up of double strands as the bases pair up together. Codons will be formed when the letters come in sets of three. Codons which are formed at the complementary strand are also known as the complementary codons. One of the strands is called the original strand while the other strand is called the complementary strand.

Original strand:             AAGCCGTTCTAGTAGCCGCCGAAGTTC

Complementary strand: TTCGGCAAGCTCATCGGCGGCTTCAAG

2 Questions:

1) What if one pair is left in the DNA? Does this means that no more codons can be formed?

2) Will there be any errors in DNA? (Like having Cytosine to pair up with Thymine)

1 Useful application:

1) With the knowledge of DNA, we will be able to understand why our bodies are formed this way and what give the instructions to our cells that will form our proteins.

DNA in fruits

Today we have an experiment on DNA in fruits. It is really interesting and fun as we can see how a fruit DNA looks like. It is my first time seeing a real DNA and an experience that I will never forget.

3 Thoughts:
1) I have learnt that DNA stands for Deoxyribonucleic Acid and it is the genetic material of cells that is made up of double strands. The double strands will then form a helical structure.
2) I learn that we have to break the physical membranes that enclosed the cells, in other word lyse, to release the nucleus by adding dishwashing detergent to the mashed fruit. The detergent will then cause the cell membranes and those surrounding the nucleus to be degraded.
3) Adding ice cold 95% ethanol in the final step of the experiment is very important because enzymes have to be protected from degrading (reducing the amount of) the DNA at that point.

2 Questions:
1) What if we add in too much detergent to the mashed fruit? Will there be any effects?
2) Why is table salt also added to the mashed fruit?

1 Useful application:
1) Since we know the steps to extracting DNA, we will be able to try out the extraction of DNA in fruits by ourselves at home. Some people may not have a chance to see how a fruit DNA looks like. Hence, we can carry out the experiment and show it to them.

(Extractions of DNA)
   

Sources: Google Images

Parts of a Microscope

Today, we have a chance to handle with microscope. We were told to try out the different parts of a microscope and to examine our cheek cells. We really enjoyed ourselves today!

3 Thoughts:
1) There are around 13 different parts in a microscope. Some examples of the parts are: eye piece (place eyes over it to examine the cells), diaphragm (adjust the light), stage (place specimens), fine adjustment knob (for clearer image), etc.
2) When we start to examine the cells, we must always start with the lowest magnification of the objective lens. We must bear in mind that we should not start with the highest magnification because if we do so, the cells that we are examining will not be clear.
3) We should always add iodine on the specimens so that we are able to see the cells through the microscope.

2 Questions:
1) When examining the cells, why when we start with the highest magnification, the image of the cells will not be clear?
2) What will happen if we prepare the slides by using more than one layer of cells?

1 Useful applications:
1) By knowing the different parts of the microscope and their functions, we are able to examine cells by ourselves. We will also be able to examine the cells without the help of others if we know the steps to operate the microscope well.

(Pictures of microscopes)
 

Sources: Google Images

Recalling Back on Atoms, Elements, Compounds and Mixtures

The headline is: Recalling Back on Atoms, Elements, Compounds and Mixtures.

The headline is so because we have done a revision worksheet on atoms, elements, compounds and mixtures in today's science lesson. The worksheet has indeed helped me to recall the concepts of the topic. Although the worksheet is quite difficult, I managed to answer all the questions. Some of the questions were really challenging. Hence, we discussed the questions with our friends in groups. At the end of the lesson, we are told to hand in the science worksheet. I really enjoyed the science lesson today as the worksheet has helped me to revise on the concepts that Mdm Riza has taught us. I hope that there will be more revision worksheets for us to do in the next science lesson! :)

(An atom)                                     (Elements)
  
(Compounds)                                   (Mixtures)
 

Sources: Google Images

Concept Map on Multicellular Organism

Today, Mdm Riza told us to do a concept map on multicellular organism, which is made up of cells, tissues, organs and systems. We had to complete the concept map and hand it in by the end of the lesson.

3 Thoughts:
1) Photosynthetic is a type of plant tissue that is found in both the stems and leaves of a plant. Its function is to make food as chlorophyll is present in it.
2) Division of labour occurs in multicellular organisms as they are made up of different types of cells. This process helps organisms function efficiently as a whole because it helps to breakdown workload so that different types of cells can perform specific tasks.
3) Tissues are formed when similar cells perform similar function; Organs are formed when several tissues work together; Systems are formed when different organs work together; Organisms form when different systems work as a whole.

(Cells)                                              (Tissue)

 

(Organs)                               (Systems)                                   

  

2 Questions:

1) In division of labour, how does the workload being breakdown? Is there a special method?

2) Does a tissue looks like similar cells being stick together?

1 Useful application:

1) By knowing more about multicellular organisms, we will be able to understand how our bodies function and why cells, tissues, organs and systems are present in our bodies. We are also able to know what make up the different parts of our bodies.

Sources: Google Images

Link to my concept map: http://www.mywebspiration.com/publish.php?i=556915a28ac0

Cells Come Alive

Today we did an experiment on cells. It was very interesting and fun! We had to make use of items that were given by Mdm Riza and brought by the members in our group so as to create an edible cell. Our group decided to make an edible plant cell.

(A plant cell)


3 Thoughts:
1) I had learnt that mitochondria, which is found in both plant and animal cells, break down food to provide energy. It is peanut-shape looking and is known as the powerhouses of the cell.

(Image of a mitochondria)


2) Golgi apparatus look like strings. Hence, we used strings in our cell that we made so as to represent the Golgi apparatus.

(Image of Golgi apparatus)


3) Plant cell contains 1 vacuole which is big in size. Vacuole contains cell sap that is made up of water and dissolved materials (e.g. sugars and mineral salts).

(Image of a plant's vacuole)

2 Questions:
1) Do the shapes and sizes of different parts of the plant cell affect the functions of the parts?
2) Do the parts of the similar type (e.g. chloroplasts) have the same shape and size?

1 Useful application:
1) By knowing the functions and appearances of the different parts of a plant cell, we are able to visualise the plant cell in our mind and know what create it.

Sources: Google Images

Activity on Cells

Today, we were told to read out the resume that we had done to Mdm Riza which is so called an 'interview'. We have to finish reading the resume in one minute. It was really fun!

I used to think that cytoplasm is a jelly-like substance which it only carry substances around the cells with no special functions. But now I think that cytoplasm is a jelly-like substance which contains chemicals and other tiny structures that carry out special functions. One example is the vacuoles that are located in the cytoplasm of the cells. Vacuoles are filled with fluid and they store food and water.

Starting Small on Cells

The headline is: "Starting small on Cells".

Today, Mdm Riza started teaching the topic cells. I had learnt that other than nucleus, cytoplasm and cell membrane being found in cells, there are also other parts such as mitochondria and vacuoles present in the cell. Mdm Riza assigned us different new parts that we had just known to do research on them. We were then told to do a resume of the part of the cell that was assigned to us. The part of the cell that was assigned to me was mitochondria. The function of mitochondria was to break down food so as to provide cells with energy to carry out activities and it is the 'powerhouses' of the cells.

Respiration

The headline is "Respiration" because Mdm Riza taught us this topic today. We had to discuss about the facts that we know on respiration with our partner first. Then, we carried out two experiments to test whether carbon dioxide and water is given out during the process.

Facts on Respiration:

• A process in which food molecules are broken down to release energy
• Water, carbon dioxide and energy are released
• Needs oxygen and glucose (from the food we eat)
• Takes place in every living plant and animal cell

Respiration is very important because it is the main factor to keep us survive.

A Mini Test on Separation of Mixtures

I used to think that forensics use chromatography method to test samples of blood as it is the best method among the rest of the other four methods (magnetic attraction, filtration, evaporation, distillation).

But now I think that forensics use the chromatography method to test samples of blood because:

• Small amount of the sample is needed
• The method is able to identify the contents of the sample
• Purity of the sample can also be tested

The test was quite challenging as it tests us on how well we know about the topic (separation of mixtures). The most challenging part was to complete the mind-map.

Non-Technology Research

The headline is: "Non-technology Research".

I chose this headline because today Mdm Riza brought us to the library to learn more about photosynthesis. At first, we have to discuss in groups on what we already knew on photosynthesis. After that, we have to share our ideas with the whole class. I have learnt more things after the sharing. The most important thing that I have learnt is the factors which are needed for photosynthesis to occur. The factors are: presence of light, water and carbon dioxide. Then, we were told to work in the same group and complete the questions given in the worksheet by either doing a mind-map or comic strip. We have to do our research on scientific journals / books / articles.

Going Through Term 3 Common Test

3 Thoughts:
1) I have learnt that mercury is a silvery metal which is a liqud at room temperature. Mercury is a good conductor of both heat and electricity. Mercury will become a solid when it is below its melting point(very low) while it will become a colourless gas when it is above its boling point(very high).
2) I have learnt that for filtration to work properly, the size of the holes on the filter paper must be very small so that insoluble substances, which are very small in size, such as pepper can be collected as the residue on the filter paper.
3) I have also learnt that if you want to get a mixture which has a very low melting point and a very high boiling point, the substances that are mixed together must also have the properties(low melting point and high boiling point).

2 Questions:
1) When we want to get a mixture which has low melting point and high boiling point, must all the substances which are mixed together have those properties(low melting point and high boiling point)? Or just one substance that has those properties will be enough?
2) Is the colour of the mercury different when it is at the solid state and at the liquid state?

1 Useful application:
1) We know that mercury is a liquid at room temperature, thus we must be careful when handling with thermometers as mercury is found in them. When we are not careful and drop the thermometer, the thermometer will crack and the mercury in it will flow out. It will be very difficult for us to collect back the mercury which is scattered on the floor as it is in the liquid state but not in the solid state and mercury is also poisonous. Hence, we cannot touch it with our bare hands.

Workbook- Chapter 6 Worksheet

3 Thoughts:
1) I have learnt that ethanol is a solvent which is a type of alcohol. When ethanol is mixed with another substance like iodine, they will form to become a mixture.
2) When using the fractional distillation method, the substance with the lowest boiling point will be found at the top most fraction as when the mixture is heated, it is the first to be evaporated and the hot water vapour will then rise in the fractionating column and condense into liquid. The boiling point of the substances that go down the column will be higher and heavier in weight.
3) I have also learnt that filter, filtrate and filtration are all different. Filter(also known as filter paper)- An apparatus used to separate insoluble substances from a mixture. Filtrate- The substances(liquid) found in the beaker (when using the filtration method) is called filtrate while the substances found on the filter paper are called residue. Filtration- The process/method to separate mixtures.

2 Questions:
1) What is the difference between filter paper and filtrate paper?
2) How long will the mixture, crude oil, be separated using the fractional distillation method?

1 Useful application:
1) Since we know that ethanol is a type of alcohol, we are able to purchase this type of alcohol by saying the correct name(ethanol) in the shop. We are also able to explain the differences between filter, filtrate and filtration to our friends who do not understand them.

National Education Lesson

I used to think that Singapore obtains their NEWater by mostly using the distillation and evaporation methods. But now I think that NEWater is obtained mostly by using the reverse osmosis method.

At first, I also used to think that reverse osmosis is not a method to separate mixtures. But now I think that when using reverse osmosis method, sea water is pre-treated to remove insoluble substances like debris and contaminants such as oil, grease and suspended solids. The sea water which has been pre-treated will then be pumped at high pressure into the partially-permeable membranes to remove all traces of soluble substances. [Soluble substances: Bacteria, chemicals, dissolved minerals, etc.]

I used to think that both reverse osmosis and desalination are the same method. But now I think that they are different as reverse osmosis is a type of method mostly used for desalination.

More Information on Separating Mixtures

3 Thoughts:
1) There is more apparatus use in fractional distillation than in distillation. The extra apparatus use in fractional distillation is called fractionating column. The substance which has the lowest boiling point will be found right at the top of the fractionating column. In addition, the substance which is the heaviest in weight will be at the bottom of the fractionating column.
2) The mixture being separated in the fractional distillation has a wide range of temperatures and there is a great difference between the temperatures. Example, there are three substances in the mixture in which their temperatures may be 30 degree Celsius, 70 degree Celsius and 120 degree Celsius. Fractional distillation is usually used to separate more than two substances from a mixture while distillation can at most separate a mixture which contains two substances.
3) By using the method called paper chromatography, a solvent (e.g. alcohol) must be used. When using the chromatography paper (long strip), a pencil mark should be drawn at around 2 or 3cm above the bottom of the strip. Ink must not be used on the strip as when it comes into contact with the solvent, the substances in it will also be separated. The pencil mark should also be above the solvent. If the pencil mark is in the solvent, the mixture will mix with the solvent and becomes another mixture. Thus, the separation of the previous mixture will not be the same and accurate. Lastly, a cock is used to cover the boiling tube so that the alcohol will not be evaporated.

2 Questions:
1) When we use the paper chromatography method, how do we know that all the substances in the mixture have been separated?
2) Why is there fractional distillation and distillation? Can the mixture which only contains two substances be separated using the fractional distillation method such that all the mixtures on Earth can be separated by the fractional distillation method and the distillation method need not be used anymore?

1 Useful application:
1) Since we know the method in using the distillation method to separate mixture, we are able to separate the substances in the mixture by ourselves if we want to use the substance which is found in the mixture. The substances in the mixture are also useful to us.

Separating Mixtures-Distillation

3 Thoughts:
1) Porcelain chips are used in boiling of the mixture in the distillation set-up so that heat will be evenly shared in the mixture and heating will be very efficient. The heat from the Bunsen burner or electric heater cause the porcelain chips to vibrate and this in turn will also cause the water to vibrate. Hence, heat will be evenly spread in the round-bottom flask.
2) Distillation set-up: The tap-water in is usually at the bottom of the condenser while the tap-water out is at the top so that it will be more efficient in condensing. The tap-water in is at the bottom end of the condenser. Thus, the hot water vapour can take time to cool down and condense into water droplets.
3) Distillation is usually used to separate different temperatures of liquid. Hence, a thermometer is used. A thermometer can be used to tell which element or compound is separated from the mixture. Example, when the thermometer reaches 100 degree Celsius, we can tell that pure water is separated from the mixture.

2 Questions:
1) If the mixture is separated by distillation method, then at the end of the heating process, will the porcelain chips still remain in the round-bottom flask?
2) When using distillation method, how do we know that a mixture has been completely separated?

1 Useful application:
By knowing more on distillation method, we are able to carry out experiments easily and know what the concept behind the method is. We are also able to answer questions on distillation with better understanding.

More on Mixtures...

3 Thoughts:
1) Evaporation is a method to separate mixtures. People usually do not heat the mixture directly so as to prevent overheating. The mixture is usually heated over a water bath.
2) Filtration is another method in separating mixtures. Filter funnel, filter paper and a beaker are used. The substance which is found in the beaker is called filtrate while the substance which was collected at the filter paper is called residue.
3) Distillation is also another method to separate mixtures. This method is usually used to separate liquid-liquid mixture of different temperatures. The apparatus being used in this method are Bunsen burner, wire gauze, tripod stand, beaker and distillation set. The mixture is heated in a distillation flask until no water is left as the water in the mixture is found in the beaker.

2 Questions:
1) How do scientists find out the methods to separate mixtures?
2) What is the difference between distillation method and evaporation method?

1 Useful application:
1) By knowing the methods in separating mixtures, we can apply it in our daily life. If we want to get salt from seawater, we can use the evaporation method.

Penny of Thoughts on Mixtures

I used to think that mixtures can be formed by combination and broken down by decomposition. But now I think that a mixture consists of two or more different substances that are mixed but does not go through any chemical reactions. Both combination and decomposition are chemical methods.

I also used to think that mixtures cannot be separated. But now I think that there are five ways to separate mixtures. The five ways are: 1) Filtration 2) Magnetic attraction 3) Distillation 4) Evaporation 5) Paper chromatography.

Mindmap on Atoms, Elements and Compounds

This is the link to my Atoms, Elements and Compounds mindmap: http://mywebspiration.com/view/500474a15b13

Workbook: Going Through Answers in Chapter 5 Worksheet

3 Thoughts:
1) I had learnt the difference between word equation and symbol equation. An example for a word equation is: Magnesium + Oxygen ---> Magnesium Oxide. But if you want to represent the equation in chemical symbol, it is like this: 2Mg + O2 ---> 2MgO.
2) Understand which are reactants and which is product. Example, Water Vapour + Carbon ---> Sugar. Water vapour and carbon are the reactants while sugar is the product.
3) Understand that element is the simplest substance and cannot be broken down further. Example, a magnesium cannot be broken into simpler substances as it is an element.

2 Questions:
1) Why did scientists change the spelling of 'sulphur' to 'sulfur'?
2) How did scientists carry out experiments to test whether which substances mix together will form another substance?

1 Useful application:
1) By knowing all of these scientific concepts, I can apply what I know to my schoolwork and examinations.

Workbook: Chapter 5 - Elements, Compounds and Mixtures

Today, we continued doing the same worksheet as we did yesterday. The lesson was also sort of interesting. Although I had quite a number of wrong answers when doing the worksheet, I felt that I understand more about the topic once Madam Riza and our classmates went through the answers together.


I used to think that the melting point of impure ice is higher than that of pure ice. But I was wrong. Now, after going through the answer, I think that ice which is made from pure water that do not contain impurities has higher melting point than an ice which is made from salt water and so called impure ice.


I also used to think that the layer of protective metal covering the iron is to make the iron becomes stronger. As you know, I was still wrong. But now I think that the protective layer of metal is to protect the iron from rusting as when iron is contacted with moisture and oxygen, it will rust.


Anyway, I came across a quote: "Anyone who has never made a mistake has never tried anything new" - By Albert Einstein. I really agree with this quote and I also like it very much! :D

Practice Makes Perfect

The headline is "Practice Makes Perfect" because we were doing science worksheet on elements, compounds and mixtures for today's lesson. By doing lots of worksheets, we will improve on our answering skill and thus able to answer challenging science questions in the future. I LOVE today's lesson as I had gain more knowledge after that. We were able to discuss answers with our partners and were also being given a time limit to complete some parts of the worksheet. Then, Madam Riza went through the worksheet with us. Although the science lesson today was sort of short, we had a great time learning together!

Fats and Sugars. How We Know?

3 Thoughts (What I have learnt):
1) Benedict's solution is used to test whether liquids contain sugar content.
2) When Benedict's solution is added to a sugar-drink, the colour of the sugar-drink plus the Benedict's solution will turn into reddish-orange or reddish-brown. If the drink does not contain any sugar, the mixture will not turn into any other colour when the Benedict's solution is added to it. [Example (Both mixtures are heated in a water bath): When Benedict's solution is added with Coca-Cola, the mixture will turn into reddish orange in colour. But when the Benedict's solution is added with Coca-Cola Zero, the colour of the mixture will still remain the same as it first uses to be.]
3) When food has a higher change in temperature from lowest temperature (haven start heating) to highest temperature (heating), it will contain more fats.


2 Questions:
1) Who invented the Benedict's solution? And why is the solution called 'Benedict'?
2) Does it mean that the food no longer contains any fats when it is burned until the remains could not be further burned?


1 Useful application:
1) After knowing how to find whether food contains sugars or fats, I am able to change my eating diet. I used to eat many peanuts. But now, after the experiment, I found out that peanuts contain lots of fats. Thus, I am now trying to cut down on eating peanuts.


As for today's Science lesson, it was very FUN, EXCITING and INTERESTING! We did many experiments and I had gained more knowledge after that. The lesson was conducted by our seniors and thus we are able to communicate with them well. Before the start of the lesson, the seniors told us what is the objectives of doing such experiments today. One such objective is to know what is a healthy and balanced diet. I feel that the seniors had put in lots of efforts in teaching us.

Expectations

3 Thoughts:
1) Knowing what are the factors that will affect my marks for the discussion forum in grou.ps. There are many factors involved which are promptness and initiative, relevance of post, expression within the post, delivery of post and the contribution to the learning community by commenting on our peers' post. The maximum points that we can score (if we did very well in every factors) is 20 points.
2) There are three ways in which we can write our learning reflections. Firstly, we can use the "I used to think...but now I think..." method. Second method is using a headline to talk about the most important aspect that should be remembered in the lesson taught on that day. Lastly, it is the 3-2-1 way of responding which I am using it now.
3) I found out why when one fruit is rotten, the rest of the fruits around it will also rot. It is because when a fruit rots, it gives out a type of gas that causes the other fruits around it to rot too.


2 Questions:
1) What is the type of gas in which causes the fruits to rot called?
2) Is the gas harmful to our body?


1 Useful application:
1) By knowing the reason why when one fruit rots, the rest will also rot, we can apply it to our everyday life. When we have a basket of fruits and if one starts to rot, we must quickly dispose it so that it will not cause other fruits to rot too.


Well, most of today's Science lesson, Madam Riza was explaining to us of what she expects to see in the responses and reflections in the discussion forum and our Science blog respectively. I really enjoyed the Science lesson today!